Sélection de la langue

Recherche

Première mention du viroïde 5 de Coleus blumei et confirmation moléculaire de la présence du viroïde 1 de Coleus blumei chez des plantes commerciales de Coleus blumei au Canada

Smith RL, Lawrence J, Shukla M, Singh M, Li X, Xu H, Gardner K and Nie X. 2018. First report of Coleus blumei viroid 5 and molecular confirmation of Coleus blumei viroid 1 in commercial Coleus blumei in Canada. Plant Disease DOI: 10.1094/PDIS-01-18-0055-PDN

Résumé

Le Plectranthus scutellarioides (synonyme : Coleus blumei, ci après appelé coléus) est une plante ornementale populaire cultivée dans le monde entier. Six viroïdes, à savoir les viroïdes 1 à 6 de Coleus blumei (CbVd 1 à CbVd 6), appartenant au genre Coleviroid, à la famille des Pospiviroidae, ont été observés à ce jour sur des coléus (Nie et Singh, 2017). Un viroïde avait déjà été détecté sur des semences commerciales de coléus au Canada (Singh et al., 1991). Bien que l’espèce exacte du viroïde fût inconnue, on a inféré que le CbVd 1 était présent. De mai à juillet 2017, des échantillons de tissu foliaire ont été prélevés sur 56 coléus appartenant à six cultivars (Black Dragon, Wizard Select Mix, Pineapple Surprise, Wizard Coral Sunrise, Premium Sun Chocolate Covered Cherry, et Wizard Rose) dans une pépinière locale à Fredericton, au Nouveau Brunswick (Canada). Aucun symptôme précis n’a été observé chez les plantes. L’ARN total a été extrait à partir de tissus regroupés provenant de toutes les plantes. L’analyse par électrophorèse sur gel de polyacrylamide à rebours (Singh et al., 1991) a détecté un fragment de type viroïde dans l’échantillon. Lorsque le fragment de type viroïde purifié a été soumis à une transcription inverse suivie d’amplification en chaîne par polymérase (RT PCR) à l’aide des amorces coleviroïdes universelles CbVds P1 (5’ GCAGCGCTGCTGCAACGGAAT 3’) et CbVds P2 (5’ GCAGCGCTGCTGCCGCCAGGAACCCAGGACCCAGT 3’) (Jiang et al., 2011), un fragment spécifique aux CbVd (~250 pb) a été produit, confirmant la présence d’un ou de plusieurs coleviroïdes dans l’échantillon. L’amplicon obtenu a été cloné dans le vecteur pCR™ Blunt (Thermo Fisher Scientific, Waltham, MA), et dix clones ont été séquencés par la méthode Sanger. L’analyse BLAST des séquences a révélé la présence des viroïdes CbVd 1 et CbVd 5, avec des fréquences de 9/10 et 1/10, respectivement. Le viroïde CbVd 1 d’une longueur de 249 nt (numéro MG767212) présentait une homologie de séquence de 100 % avec la plupart des séquences CbVd 1 déposées dans GenBank, tandis que le viroïde CbVd 5 d’une longueur de 274 nt (numéro MG767213) présentait une seule substitution de G par C à la position 54 par rapport à d’autres isolats CbVd 5. L’ARN a ensuite été extrait à partir de tissus regroupés provenant de toutes les plantes de chaque cultivar et soumis à la RT PCR en utilisant les amorces coleviroïdes universelles ainsi que la paire d’amorces CbVd1 F1 (5’-GAGCTTGGCTCGAACTGACT-3’)/CbVd1 R1 (5’-CGAAGAAGAAGCCGAAGCTA-3’) propre au viroïde CbVd 1 (taille de l’amplicon, 144 pb) et la paire d’amorces CbVd5 F1 (5’-GAAAAGGCAGGTTGCTTACC-3’)/CbVd5 R1 (5’-AGCAGGAACCCGGAAGAC-3’) propre au viroïde CbVd 5 (taille de l’amplicon, 171 pb), nouvellement conçues. Ces analyses ont indiqué que le cultivar Wizard Coral Sunrise n’était infecté par aucun viroïde CbVd, que le cultivar Black Dragon était infecté par les viroïdes CbVd 1 et CbVd 5, et que les quatre autres cultivars étaient infectés uniquement par le viroïde CbVd 1. Afin d’étudier davantage la prévalence et les symptômes d’infection par les viroïdes CbVd chez les coléus, nous avons fait germer soixante semences commerciales de chacun des cultivars Black Dragon, Pinto Mix et Wizard Mix, et les semis ainsi obtenus ont été repiqués et cultivés en serre à 20 25 °C avec un cycle lumière/obscurité de 16 h/8 h et une humidité de 75 %. Les épreuves de RT PCR des plantes au moyen de la paire d’amorces coleviroïdes universelles ont indiqué que les cultivars présentaient des taux d’infection différents : 0 % dans le cas de Pinto Mix, 20 % dans le cas de Black Dragon et 35 % dans le cas de Wizard Mix. D’autres analyses des échantillons positifs quant à la présence de CbVd en utilisant les paires d’amorces propres au viroïde CbVd 1 et au viroïde CbVd 5 ont montré que tous les échantillons positifs étaient infectés uniquement par le viroïde CbVd 1. Il est intéressant de noter que la plupart des plantes des cultivars Wizard infectées par le viroïde CbVd 1 étaient d’une couleur significativement plus claire que celles qui n’étaient pas infectées par le viroïde (figure supplémentaire 1). Cependant, chez les plantes du cultivar Black Dragon, aucune différence visible n’a été observée entre les plantes infectées et les plantes non infectées, ce qui porte à croire que le génotype de l’hôte joue un rôle dans l’apparition des symptômes induits par les viroïdes CbVd. À notre connaissance, il s’agit de la première mention du viroïde CbVd 5 et de la première détection confirmée du viroïde CbVd 1 chez les coléus au Canada. Compte tenu de la propension apparente des coleviroïdes à se recombiner et à évoluer (Nie et Singh, 2017) et de la capacité des viroïdes en général de causer des symptômes de maladie non seulement chez les plantes ornementales, mais aussi chez les espèces de cultures importantes sur le plan économique, des précautions pourraient être nécessaires pour réduire autant que possible la propagation de ces viroïdes.

Signaler un problème sur cette page
Veuillez cocher toutes les réponses pertinentes :
Date de modification :