Sélection de la langue

Recherche

First Report of Bronze Leaf Disease on Poplar in Alberta, Canada and Sequence of Apioplagiostoma populi.

Kawchuk, L.M., Howard, R.J., Kalischuk, M.L., Northover, P.R., Desjardins, M., et Spencer, R.C.J. (2010). « First Report of Bronze Leaf Disease on Poplar in Alberta, Canada and Sequence of Apioplagiostoma populi. », Plant Disease, 94(3), p. 377. doi : 10.1094/PDIS-94-3-0377A  Accès au texte intégral (en anglais seulement)

Résumé

En Alberta et dans le reste de l’Ouest canadien, le peuplier (Populus spp.) est une essence de valeur : en raison de sa croissance rapide, de son architecture et de sa rusticité, il est très utilisé en horticulture, dans la plantation de brise-vent et pour la production de pâte et d’autres produits de bois. Le peuplier est également une composante importante des peuplements forestiers indigènes de la forêt-parc des Prairies. Jusqu’à récemment, des cas d’infection par l’Apioplagiostoma populi (Cash & A.M. Waterman) Barr n’avaient été observés en Amérique du Nord que dans le Canada central et dans l’est et le midwest des États-Unis. Des symptômes de l’infection fongique (3) ont été observés pour la première fois en Alberta en 2003, et depuis on en observe chaque année chez un nombre croissant de sujets de Populus × canescens Smith, de P. tremula L. et de P. tremuloides Michx. de pépinières, de paysages urbains et de plantations brise-vent. Des symptômes foliaires ont été observés sur 10 à 50 p. 100 du houppier des arbres infectés. Chez les feuilles atteintes, le limbe est de couleur bronze, et les nervures et le pétiole sont vert et jaune. Les symptômes s’accentuent entre le milieu et la fin de l’été. Les feuilles deviennent alors bronze à brun rougeâtre foncé, le pétiole et la nervure médiane demeurant verts. Un certain nombre de feuilles infectées demeurent attachées à l’arbre tout l’automne et l’hiver et continuent le cycle d’infection au printemps. À mesure que l’infection progresse, l’A. populi colonise les tissus de la tige et des branches, et les feuilles se flétrissent, perdent leur couleur et meurent peu de temps après. Souvent, les branches infectées meurent au cours de la saison. La mort des branches réduit de façon importante la valeur esthétique et commerciale de l’arbre. Les rejets de sujets infectés meurent souvent avant d’atteindre l’âge de 5 ans. Les symptômes d’infection par l’A. populi ont été observés chez plusieurs espèces de Populus, et la mort précoce des arbres infectés est un frein à l’utilisation de ces essences (1). On a tenté d’isoler le pathogène au moyen de substrats artificiels mais sans succès (4). À l’automne 2008, des feuilles d’arbres infectés ont été prélevées, placées dans des sacs en filet puis suspendues à l’extérieur pour l’hiver. Le printemps suivant, des périthèces brun foncé de 150 à 200 × 100 à 150 μm sont apparus sur les deux faces des feuilles. Les asques, de 30 à 40 × 10 à 14 μm, étaient fusoïdes-clavées et présentaient un anneau apical distinct. Elles renfermaient des ascospores hyalines ellipsoïdes-clavées de 10 à 14 × 3 à 6 μm, à deux cellules, la basale relativement courte. Des périthèces ont été isolés, puis de l’acide nucléique en a été extrait et amplifié par réaction en chaîne de la polymérase (PCR) avec les oligonucléotides 5′GCATCGATGAAGAACGCAGC3′ et 5′TCCTCCGCTTATTGATATGC3′ spécifiques de la région des espaceurs transcrits internes (ITS) de l’ADNr (2). Le fragment cloné et amplifié de la région ITS de l’ADNr de l’A. populi (spécimen GU205341 de GenBank) présentait une homologie de séquence nucléotidique de plus de 90 p. 100 par rapport aux autres Apioplagiostoma. La présence de l’A. populi a été révélée chez 33 échantillons de feuilles provenant de neuf arbres qui présentaient des symptômes par une séquence d’environ 300 paires de bases, lesquelles n’étaient observées chez aucun des échantillons provenant d’arbres ne présentant pas de symptômes. Depuis une centaine d’années, le peuplier et le tremble sont très utilisés dans l’Ouest canadien, en milieux urbains et ruraux, et la propagation de l’A. populi menace les pépinières, les plantations brise-vent et l’industrie de la fabrication de produits de bois.

Signaler un problème sur cette page
Veuillez cocher toutes les réponses pertinentes :
Date de modification :